Human Variation and Race

1. Heat! The body temperature of a healthy human beings is 98.6 degrees Fahrenheit. Our body temperature is very sensitive to changes either higher or lower to our average body temperature. When our bodies overheat we run the risk of heat stroke. Experiencing heat stroke will easily disrupt homeostasis as it can cause someone to become light headed, experience dizziness, and even lose consciousness.

The best short term adaption the human body has is it's ability to sweat. Our bodies sweat in order to attempt to cool down our body temperature if it rises too high. However if the weather is dry sweating too much can cost the body  water and salt which could cause death if not remedied quickly.

 A bodies facultative adaptation to heat is the process of vasodilation. What vasodilation does is expand the blood vessels to increase blood flow to the area of the body where it's needed most. In regards to overheating of the body what vasodilation does is bring the heated blood to the skin where it can be released into the atmosphere.

 A developmental adaptation to heat is bipedalism. Over time we as humans have gained the ability to walk on two legs. There are many benefits of bipedalism to our species, one of those benefits is that by walking upright our bodies are in less contact with heat from the sun.

A cultural adaptation to extreme heat is the invention of air conditioning. While not all people have  access to air conditioning, those who do use it to maintain low body temperature. Our clothes are also a method we can use to control our body temperature by removing them when it gets warm.

3. The benefit of studying the heat in regards to human variation helps us understand how to survive in different environments. By understanding how people survive in harsh climates we can learn how to survive in those climates as well.

4. I'm not sure we can use race to understand how to adapt to certain weather conditions. I believe we can learn more from the culture of a group of people in order to survive. I believe this because people of different races are capable to survive in most every environment. It's just that a different culture have adapted to their environment and are used to it.

Language

Part 1
I had this conversation with my friend Miko. This  assignment proved to be pretty hard which I'm sure was the point of this assignment. Part of what made this assignment so difficult was that I couldn't properly explain what I wanted to. I told my friend ahead of time what this assignment was so he was prepared for it. At first we were able to have simple conversations, I could answer yes or no answers easily. However as time went on and the conversation became more complex, it became much harder to verbalize my thoughts. I could tell me friend was getting a little frustrated during the span on of our conversation and it was equally frustrating for me.

My friend definitely had control of our conversation. He was more capable to control the flow of our conversation. He was able to not only change the topics we were discussing, he could change the tone, and was in control of when we switched topics. While he had most of the control, I had almost on control.

The culture with spoken word is definitely more advantageous in communicating complex ideas. The culture that had a more advanced speaking pattern would look down on the less advanced culture. They would feel more superior than the nonverbal culture, that's how I felt as someone who had no say in a conversation. I feel a modern example of this would be tourists visiting another country, In fact I deal with this personally all the time. I work at Six Flags Magic Mountain and we often get a large number of people who don't speak English that well or at all. Trying to communicate with these people can get frustrating for me and them. It leads to the point of both of us using awkward hand signals to communicate, much like the ones I used to attempt to communicate with my friend.

Part 2
I believe this part was much harder for me than the other. I use body language a lot in the way I communicate. I can also tend to be quite sarcastic and the inability to convey tone makes this much more difficult. My friend enjoyed my watching to struggle with this task. Over time though, he would get confused on what message I was trying convey and what I intended to get across.

While I understood how important body language was, it took this assignment to realize how much I use sign language. When you observe other peoples body language you can tell how they intend their message to be received as well as how the persons emotions are.

Their are lots of benefits as to why being able to read body language is important. One of these being, being able to tell what someone else might be thinking is a very important trait to have, You could tell if someone is threatening you, you could tell when someone needs help, and you can tell by the way someone carries themselves that they might be a possible mate.

One of the most blatant examples of someone not being able to read body language are the blind. Without being able to read body language the blind seem to do fine in their day to day life. I think a situation on when reading someones body language isn't all to helpful is talking with someone who is panicked or frightened. For the most part you can tell when someone is scared but you don't how that person will react to you approaching them for comfort. I think in this situation being able to read body language is unreliable.

Piltdown

1. In 1908 a worker in the English town of Piltdown allegedly presented a skull fragment to Charles Dawson. In 1912, four years after the initial find, Dawson told the Geological Society of London that the skull was very similar to that of modern day humans. He believed that the skull belonged to a        so called "missing link", our ancient ancestor that allegedly connected apes and humans. If the findings were accurate the Piltdown man would have shown that our brains developed faster than our omnivorous diet, which would be a significant finding if it were accurate.

Because the Piltdown man was the believed "missing link", other remains found in other parts of the world were mostly ignored. These remains would have pointed scientists in the right direction about our earliest ancestors, instead they were sidetracked on how to discover how the Piltdown man fits into what was known. Over time the validity of the Piltdown man was eventually questioned.

In the decades after the finding there became better methods to more accurately date remains and fossils. One of these methods was the fluorine absorption test, which would eventually discover the truth about the Piltdown man. It was found that the part of the bone fragments was actually a jaw from an orangutan that was combined with a piece of skull from a modern day man. Teeth that were discovered were also found to be filed down. Dawson died before the hoax was revealed so it is unlikely that we will know that Dawson was behind the hoax. Arthur Woodward, who worked at the British Museum, assisted Dawson in his findings. It is believed that Woodward had nothing to do with the hoax because he was still working the site after Dawson died, hoping to find more remains. To this day we only have ideas on who committed the hoax but no solid proof on who did it.

2. The main fault here is that the scientists who analyzed the remains didn't verify the findings. Arthur Woodward was highly respected at the time and people believed what he had to say They chose to believe in the Piltdown man because it fit into what they wanted to find. This lack of scientific verification was a major setback in evolutionary science when other findings were dismissed in favor of the Piltdown man.

3. After doubt about the validity of the Piltdown man began to rise, more research into the discovery done. One of the main tools they used was the fluorine absorption test which was how they discovered the true age of the remains. The amount of fluorine that is absorbed by the bone can approximately determine how long the bone was in the soil.

4. I say you could remove the human element from science to verify all findings. I wouldn't want to remove the human element though. Humans have a natural need for curiosity and discovery that machines and computers don't have.While humans can be prone to hoaxes, it is humans who find out the truth to these hoaxes.

5. Verifying your sources is a very important aspect of the scientific community, especially at the time of this discovery.  In this day and age verifying your sources is still very important. Taking everything you read online at face value could leave you easily misinformed on a variety of different issues. As could be seen in this instance not verifying your sources could potentially setback the scientific community for decades. Always make sure you have verify your sources is a very important lesson to learn!

Comparative Primate

Lemurs: Lemurs are native to Madagascar and found almost nowhere else in the world. The environment in Madagascar changes drastically at times from with a humid hot season to a dry season. Stereotypical lemurs are herbivores eating leaves and fruits. However mice and dwarf lemurs are omnivores eating the same as regular lemurs as well as small animals. While the lemurs do have preferred food they usually wont be too picky when hungry, eating anything the environment gives them. Which helps them surviv
e when fruit runs low during the drier seasons.



Spider Monkey: Spider Monkeys can be found in the rain forests of South America. The climate in these rain forests are usually warm and rainy. The Spider Monkey diet is similar to that of the Lemurs. The Spider Monkeys are usually omnivores eating fruits and seeds but also insects and even small bird eggs. When their is a large amount of food available the Spider Monkeys will usually live in large groups, if it is not a particular abundant food season they will live separately in order to get the food for themselves.

Baboon: The Baboons are native to Africa and are very adaptive to the environment around them. As long as Baboons have water and a tall place to sleep (like trees) they are set to live. Baboons are also mostly omnivores as well. They eat berries, seeds, leaves, fish, birds, hares, and even small antelopes. Like most primates the Baboons diet usually consists of whats around them in their environment. During seasons where food is scarce the Baboons could also eat bark, sap, and even velvet monkeys to survive.

Gibbon: Gibbons are found native in South Asia. The regions in which the Gibbons have active monsoon seasons and tend to be warm in temperature. Gibbons are also omnivores eating fruit, seeds, leaves, insects, spiders, and small birds. Gibbons, like other primates, are very adaptive to the surroundings around them in regards to their diet. When their preferred food source is low the Gibbon is able to eat whatever is necessary to survive.
                                                                                                             
                                                                                                                (Not the usual Diet)

Chimpanzee: The Chimpanzee is normally found in central Africa. They are usually found in rain forests or areas that are near rain forests. These areas tend to be humid and dry at times. Like the other apes in this post the Chimpanzees are omnivores. They have no problem eating leaves, fruits, seeds, insects, and small bird eggs. Dr. Jane Goodall has even found that Chimps hunt for food. These Chimps are very adaptive to the surroundings around them in regards to their diet. If one food source is low they can survive off what is around them.

Summary: These primates share very similar characteristics in regards to their diets. Over the course of writing this post I found that these primates live in very similar environments and are able to thrive in the environments they do live in as long as they don't lose their homes to logging.

Analogy and Homolgy

Homology

          1. For my homologous trait I picked the skeleton of a frog and a skeleton of a homosapien. One of them is an amphibian and the other is a present day human being.

   
          2.  Both of these species have a similar bone structure but with many differences between the two. The skeleton serves the same basic purpose between the two species for the most part as support and protection. But once the species separated the skeletal structure changed over time in order for both species to adapt to their surroundings.

         3. The common ancestor to these two species would be one of the first species to ever have a skeleton or vertebrae because, besides the skeleton, the two species have very few similarities. I know this common ancestor had this trait because all animals with a vertebrae share that ancestor.



Analogy

         1. For my Analogous trait I chose opposable thumbs in Gorillas and Pandas. Both species exhibit this trait but don't share a common ancestor who
does.

         2. The gorillas opposable thumb is similar to that of a human being, they also serve a similar purpose. A pandas opposable thumb isn't necessarily a digit like our thumbs but rather an enlarged bone called a sesamoid bone. However it has the same purpose as an opposable thumb. The panda primarily will use the bone to grasp bamboo to eat.

        3. Out of the bear family pandas are the only one to have opposable thumbs, meaning that they developed their thumbs on their own compared to a species more closely related to them then gorillas.

DNA

ACGTTTACCATAGTCAAGAGTAAATATTGCCATGCATCGTAC

Alfred Russell Wallace

1. I believe that Alfred Russel Wallace was one of the biggest influences of Darwins' theory of evolution.

2. One of Wallaces greatest contribution to science was actually a theory of natural selection so similar to Darwins theory. So much so that their findings were both included in a paper that was published. Darwin and Wallace still had their differences though when it came to natural selection. Wallace believed that a changing environment forced species to adapt to their surroundings as opposed to Darwins survival of the fittest belief. Another strong contribution by Wallace was the theory of warning coloration in regards to animals. Wallace believed that one way animals adapted over time to avoid predators was this change in colors. Wallace first mentioned this theory when Darwin wrote to Wallace asking for help in understanding caterpillars color scheme.

3. If the environment changes, the traits that are helpful or adaptive to that environment will be different. Wallace and his research definitely showed how when environments change the plant and animal life change with it. The research that Wallace did showed that in the situation where an environment changes the newer generation of species with more adaptive traits would survive. The research Wallace was doing helped support the research that Darwin was doing at the time. Which showed that Darwin wasn't the only person with the same ideas.

4. At the time of Wallaces research Darwin was doing his own on natural selection. Without Wallace Darwin might have been able to finish his research and publish his findings. With Wallace, though, Darwin had someone he could ask questions to. Darwin had someone who could compare findings too as well as exchange notes. It's easy to say that without a doubt Wallace definitely played a big role in Darwins research

5. At the time of publication of On the Origin of Species many publications that reviewed the work were hostile towards Darwin and his findings. Darwin himself was mocked and ridiculed through his life. Not everyone was hostile towards Darwin though, many people saw Darwins work as genius and showed him great respect. So much so that at the time of his death public opinion was swaying in his favor. Darwin himself was religious up until his death.

Works Cited:
http://people.wku.edu/charles.smith/wallace/S043.htm
http://people.wku.edu/charles.smith/wallace/S020.htm
http://darwin200.christs.cam.ac.uk/pages/index.php?page_id=e6